Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13504F4
Clone ID IST13504F4
Vector VICTR74
Project tigm

Sequence tag IST13504F4HMF1
Sequence
ATACAAATTAAGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGG
GAAACTGTGTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGANAAAA
ATGACTTTACAATAATGTTTTCTTTTTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779930..84780121 190
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592633..29592824 190
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654448..41654639 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776704..115776895 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939799..136939990 190
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920231..52920422 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809871..10810062 190
NO GENE  


Sequence tag IST13504F4BBF1
Sequence
ATACAAATTAAGGTTTGATTGTTCANCATTTTAAAACACCNTCTACAGCACACAACNANATNATCTGTGCTGGAACAGGG
GAAACTGTGTCTTAANACTCCGCCCCACANAANCTANTTGGGCCCACGTGGGCCAACNATCGGCTGGGAGGATNANANNN
NTGACTTTACAANANTGTTTTCTTTTTGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000048332


For any suggestions or comments, please send an email to unitrap@crg.es