Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999D4
Clone ID IST14999D4
Vector VICTR78
Project tigm

Sequence tag IST14999D4HMR1
Sequence
ANNTTGTTNNANACCACCCTGACTCCCCANCCCCGTGGGATTCCAGCTCANCCTGCTAGCACTTANATTCTTGTGTTCCT
TTCTTGGCTCTTAGCCCGAGAGGAGGCAGCTTCCTTANACTAGAGACAATCATTTAGAGGTTTAGGCTTAAAGTCTTCCT
CAAAATAACTCANACCGAACGCATTCATTTAAATGGCATCCACGGGGATAAAGCAAGCAGATTGCAAGTGCCTGGGAGCC
TGAACACTTCCTAAGCTTAGTGTCTTCACAGAGGATGCCTCCACTGGGTCATTCTGCAGAACTTTCCACATTGGGTTAAG
CTGGACTANAANATN
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98012768..98013098 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]


Sequence tag IST14999D4HMF1
Sequence
TACTTAAGAAAACAGTTTGTCTAGAAGGCCTACAGGATGTGCACCACTCTGCATCCTGTGTTTATGCTGCTGTGTTTTCT
AANTCTCCCCCANAAAACCAGGAGGCAGAGTCTAACCTGTCACCTTGGATCCCATCCCACTGGGAGAGAATGTCACTGTC
ACAATCTCTCATCTTGCAACCACTGTATGATTAAAACAAAAGGTGCTCCTGAANACCCTAGGGAGACAACGTGCTCTCTG
GTTTAAAATCATGCAAACATCAAAATATCCANACATAATTTATACATACGGTTATACAAAAAACACCTTCNACATAAAAC
GAATCATCCTTTCCAACATTTTTTAAAGACCCCANAGACATAAATCTGCNTGCTAAGGAAATGACCCCCAAAATGCACAC
NTATACTTAACTTGCGTCNANNAAGAAGGCANAGAAAAANACTGCTATTACNGNGNNNNNNAAAAGGGCNCCTANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14999D4BBF1
Sequence
TACTTAAGAAAACAGTTTGTCTAGAAGGCCTACAGGATGTGCACCACTCTGCATCCTGTGTTTATGCTGCTGTGTTTTCT
AAGTCTCCCCCAGAAAACCAGGAGGCAGAGTCTAACCTGTCACCTTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98012619..98012749 131
NO GENE  

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es