Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0441
Clone ID DC0441
Vector pGT1lxr
Project sanger

Sequence tag DC0441
Sequence
CGGTCGGCCGCCCCAGCACCCAGGCCGGGGAGGGAGTGACTATCTATTTTGTCTTTCACCTGAAGGTGAGCAACCAGCGG
GCGCGGGTGGGGGACCGGCTTGAATACGAGGGCTGCAAACTTGGTCGGGGCAGGTACGGGCACGTCTACATGGCGGAGAG
GGAGGAAGGGAAGGACGATAAAGACTACGCTTTAAAACAAATAGAAGGAACTGGAATTTCTATGTCGGCATGCAGAGAGA
TAGCATTACTCCGAGAGCTTAAGCACCCAAACGTCATCTCCCTTCTGAAGGTGTTTCTGTCTCATGCTGATCGGAAAGTA
TGGCTTCTCTTTGACTATGCTGAGCATGACCTCTGG
Sequence Type mRNA
Unitrap ID UNI1297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147043228..147079901 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es