Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10318H7
Clone ID IST10318H7
Vector VICTR76
Project tigm

Sequence tag IST10318H7HMF2
Sequence
CACGCACGGAGACAGAGACAGACACGAAACGACCGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30769 UNI30770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133539962..133540000 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4627977..4628015 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60398661..60398699 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67993856..67993894 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54916908..54916946 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 61009254..61009292 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003228 (Grk5) NM_018869 G protein-coupled receptor kinase 5 Gene [Source:MGI Symbol;Acc:MGI:109161]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15950314..15950352 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 66900813..66900851 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 15169108..15169146 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23721731..23721769 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 73243295..73243333 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44405136..44405174 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62287625..62287663 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041729 (Coro2b) NM_175484 coronin, actin binding protein, 2B Gene [Source:MGI (curated);Acc:Coro2b-001]


Sequence tag IST10318H7BBF1
Sequence
CACGCACGGAGACAGAGACAGACACNAAACGACCGNTGGCCNNCTTACCTCCCGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041729


For any suggestions or comments, please send an email to unitrap@crg.es