Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14836H4
Clone ID IST14836H4
Vector VICTR76
Project tigm

Sequence tag IST14836H4HMR1
Sequence
AACCCTGTTCTCANTCTATATGTGACTCTGTATTTTGAACTTGGAGCTGTCAGTATATGGGAAGTTGTTTTTCATCCCTT
CCNNCNNAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14836H4HMF1
Sequence
TTTGGACATAGTGAGTACATTCCATAAGTCAGTTGGATGGAGGGAGTAAGTCAGTAGGGAAACCAAGGTTTAGGGTTCTA
CCTGTGTTGGGCATCCCTTCCCTGGACAGACAACTCTGTGAGAGAAATCCCAATAGCGTCAGCTTGGGGCCACGGCTTCA
GGGTGCCACAGTGGGTAGGGCCAGGGCAAGGAAATANTGAAGTCCTCTCTCNAAGAGCAGTCCACCAGAGGGCCCTCCCA
NAGGGCGGGGCTTCTGCCCNNANNANNGNAAAGGCTCCGGGAGACGGAA
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123032869..123033156 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es