Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10852A9
Clone ID IST10852A9
Vector VICTR76
Project tigm

Sequence tag IST10852A9BBF1
Sequence
CCTTCACCAGNGTTTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGC
TCCACCTNCCCGGCGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCTCGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391539..57391690 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST10852A9HMR1
Sequence
GAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTA
GCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCTCCCGACGTACGCAGTTTTATCCGGTAAAGCGAAT
GATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGG
AGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGG
TTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 44964941..44965321 354
 
EST/CDNA Est Name
  BY410671.1 - BY576693.1 - BY402476.1 - BY577731.1 - BY576749.1 - BY411255.1 - BG792394.1 - AA242526.1 - BI899787.1 - BI899663.1 - W20589.1 - AA412758.1 - CV305342.1 - CV305401.1

 
Come back to gene BY410671.1 - BY576693.1 - BY402476.1 - BY577731.1 - BY576749.1 - BY411255.1 - BG792394.1 - AA242526.1 - BI899787.1 - BI899663.1 - W20589.1 - AA412758.1 - CV305342.1 - CV305401.1


For any suggestions or comments, please send an email to unitrap@crg.es