Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14278B2
Clone ID IST14278B2
Vector VICTR74
Project tigm

Sequence tag IST14278B2HMR1
Sequence
GTTCTAACTTCCCTTCAAGNNTCGGTTTGACTTTTGATGTGTTGAGGCTTATCCTGCTCACTCGGGAGAGAGAGAAAAAT
CCTCTTGGGTGTATCATTAACGTCTACATTAAGTGTAGATACTCCCAAGCTTAAAAGTTCCCAGCTGCTTCTAAGTGGGA
AGGTACAGATGTGCGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56099873..56100084 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]


Sequence tag IST14278B2BBF1
Sequence
GAACAACAGGAAAGGTGGAGTCTCAGGTATTAATCAGTGGGTGACTTTCCTATAGTTCCCTTCCCTCGGGGTATACAAAG
TTTCTACAGTTCACAAGAGCTACACCTCTGCAATACCGTAATAAAGGCAGAGTATGTGCCATTCCTTCTCTCTGCGGGAT
TTGGAAACAGCTAAGCAACCAAGCTCTGCTCCTTATGCGGAAGGAAATGCAGCCTTCCCTTCTCGTGGCTGGCTTTAGAA
CCAAATTTCCCGTGTAAAGTCNGCAATAGAAGAATCCCNNCCTCAAAGAATGATGGGGCAATGTTGAAGATTATATATAT
ATATATATATATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56099544..56099876 327
NO GENE  


Sequence tag IST14278B2HMF1
Sequence
NANAACANCAGGAAAGGTGGAGTCTCAGGTATTAATCAGTGGGTGACTTTCNTANAGTTCCCTTCCNNCNNGGTATACAA
AGTTTCTACAGTTCACAAGAGCTACACCTCTGCAATACCGTAATAAAGGCANAGTATGTGCCNTTCCTTCTCTCTGCGGG
ATTTGGAAACAGCTAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es