Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D031G04
Clone ID D031G04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D031G04
Sequence
GTNNNCTAAGGAGAGACTCTACAGGAGCAGGTAATTCACTGGTCCACAAGCGGTCTCCTTTACGTCGAAACCAAAAGACC
TCAGCATCCTTGAACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAANNNCAGCATGTAAATTTGAAGAGGGTCAAGA
TGTCTTAGCTAGATGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCA
TCATATTTGAGGACAGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAACAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509842..108510237 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 5SD031G04
Sequence
TAAAGAACAAAATGTTCTTAAATGTTAAGGAGACAGTAATTTCTTGCTTAGGTGACACGTATAAATAATTGGTACTCCAA
CTTTTGTTGCAGTAGAATTCTCTGTGTACAGTATTAGACACTATATTTCTAGATTTAAGCCATGAAATAATTGTTATCTT
TCATAA
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108515112..108515278 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SD031G04
Sequence
CCAGAAAGGAAGCCATAACTGCCATGACTAGTAGTCTCTGTAGCCTTGNNNTACTAATATAAAAAAGATGTGAATCTGAA
CCTGAGTAGAAGTGTTCTGCAGAGAAGTTTTAGTGTTAATAAATCTTTCCCAG
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108515304..108515437 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es