Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11244C4
Clone ID IST11244C4
Vector VICTR76
Project tigm

Sequence tag IST11244C4HMF1
Sequence
AAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGTTACACAGAGAAACCN
Sequence Type genomic DNA
Unitrap ID UNI30772 UNI30773 UNI30774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21221922..21221979 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81217121..81217178 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4774270..4774327 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25106718..25106775 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64227224..64227281 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48534228..48534285 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 78172185..78172242 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41376443..41376500 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19978148..19978205 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030400 (Ercc2) NM_007949 excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene [Source:MGI (curated);Acc:Ercc2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111055897..111055954 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126424973..126425030 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028833 (Ncdn) NM_011986 neurochondrin Gene [Source:MGI (curated);Acc:Ncdn-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54495949..54496006 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 117842234..117842291 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034755 (Pcdh11x) NP_001074854 protocadherin 11 X-linked Gene [Source:MGI (curated);Acc:Pcdh11x-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22880408..22880465 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107359950..107360007 58
NO GENE  

 
Come back to gene ENSMUSG00000034755


For any suggestions or comments, please send an email to unitrap@crg.es