Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11560F1
Clone ID IST11560F1
Vector VICTR76
Project tigm

Sequence tag IST11560F1HMR1
Sequence
CTTATTGGCGCTGGTCCCTCCTGCTGACTCTAGCCGAGGCTGAGGCCTGGCTATTCCTGCTAGGTCTTGCCACCGTTGGT
GCTAACCCCC
Sequence Type genomic DNA
Unitrap ID UNI30237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88165484..88165572 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005621 (Zfp592) NM_178707 zinc finger protein 592 Gene [Source:MGI (curated);Acc:Zfp592-001]


Sequence tag IST11560F1BBF1
Sequence
GGAGCACAGATCANTGAAGACGTGAGAGCGACAAGCGTCCGCTACCTAAGTAAGCCAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 88165382..88165443 60
NO GENE  

 
Come back to gene ENSMUSG00000005621


For any suggestions or comments, please send an email to unitrap@crg.es