Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10900B3
Clone ID IST10900B3
Vector VICTR76
Project tigm

Sequence tag IST10900B3HMR1
Sequence
TTGGTAGCAAATTTATGTGCACATCCTCTGGTAACCGCANATGAATAAATCAAAGTTCCCGTCGTTGCTGACTTTGCTAA
TTTAATTAAGCCGTCGAAATTTTTCCCCTTCTTTAGCCTTTTGAGTGCTTTTATGTCTGGGAAAACGTAAAGGAATTTTT
GTGTGTTAGTGAAGAATAACAACCACATATAAAGTGGCTTTCTATGATGAATGGCAACCTTCCTAANCCTTGCCANCACA
TTCTTATATTTAATCCCTTAGCGGGCAGGGATTTATACNCTGTTTTATACATTAAAAATTTTCCTTGGTGAAGTAAAGAG
CCTTCCTTCATCAGGCTGGGTATTTTANAACTAAAAAATAAAAAATAGAGAGGANNTGGAATATAGCACANCACTGCAAA
TGTACNTATNTNNTNNNTTTCCTCTCTANTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59463970..59464404 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]


Sequence tag IST10900B3BBF1
Sequence
CCATGAAGGTTTCCTTACATTTTTGTTCTTANATTGGTCTGANCATTTGTCAGGAAAGGCTTTATTAAAAACTGTTATCT
AGTAGAACTAAAATTGATGTGTACTTCTAAATTAGTAGGCAAACAAAGATGAGCCCCTATACAATAGTTTATTAAAACCA
CCTTGTTGTTCTGAATAAAACCAAAAGTGTTCAACACCAAAAAACGCTTAGGAGACACATGCCAAAAAGGTACAGTATGC
TGTTACACCCANATCCCCAGGCCGACAACAAAGGATACCTTCTCAACACACCCANACCCATTCCACTTTACCTCCTTGGC
ATGCTAATAATANAATCAATTACAAAGAGATTCTANNACATTACTTCCTGGGGCTGGANAGATGACTCAGTGGTTGGGAG
CACCAACTGCTCTTCCANANGCCCTGAGTTCAAATCCCAGCAACCACATGATGGCTNACAACNNTCTGCAATGAGATCTG
T

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59463493..59463972 454
NO GENE  

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es