Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14611A4
Clone ID IST14611A4
Vector VICTR74
Project tigm

Sequence tag IST14611A4HMR1
Sequence
AACCACTCTTGATTGATTAATATTCAACTCACANCCTAACACCATTATACCTCATACCTGAAGAAAAGTGTAACAACATT
TTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI11955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97085578..97085665 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062797 (l7Rn6) NM_026304 lethal, Chr 7, Rinchik 6 Gene [Source:MGI (curated);Acc:l7Rn6-001]


Sequence tag IST14611A4HMF1
Sequence
TTTTNNGTTGGAAACAGATACTGCTAAGTAACCCTGGCTGGCCTGGTACTGGCTTATGTAAATCTGCCACATCCCTTCTG
CTAATTTAGAATGAGTTTAACTCTCTAGCATGAAGTGTTGAGATTACAGTTGTATACTATCAGTCCCGGCTCAATAATAC
ATATGTTTTTAAAGTCAAATACATATGAAATAAAGTAATAACAAGATGTTTAAAAATGCTAAGAAGAAGCCAGGCGTGGT
GGTGCACGCCTTTAATCCCAGCACTCGGGAGGCTGAGGCAGGCGGATTTCTGAGTTTGAGGCCAGCCTGGGCTACAAAGT
GAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCTTGTCTTGAAAAACCAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 97085664..97086046 379
 
EST/CDNA Est Name
  BB760338.1 - CK621215.1 - BG086880.2 - AA426721.1 - C88700.1 - AI037128.1 - AI663786.1 - AI157568.1 - AA434709.1 - CJ163649.1 - AA623430.1 - AA221982.1 - BE627572.1 - BE627635.1 - BF012911.1 - CJ171683.1 - CA459572.1 - CJ185314.1 - CJ184352.1 - AA881096.1

 
Come back to gene BB760338.1 - CK621215.1 - BG086880.2 - AA426721.1 - C88700.1 - AI037128.1 - AI663786.1 - AI157568.1 - AA434709.1 - CJ163649.1 - AA623430.1 - AA221982.1 - BE627572.1 - BE627635.1 - BF012911.1 - CJ171683.1 - CA459572.1 - CJ185314.1 - CJ184352.1 - AA881096.1


For any suggestions or comments, please send an email to unitrap@crg.es