Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14484B8
Clone ID IST14484B8
Vector VICTR74
Project tigm

Sequence tag IST14484B8HMR1
Sequence
GTGTGCATATGTATGTGGACAGCAGCTGCTTGTAGCATGGTGGCTAGGCTCTGAACACAAACATCCCANAGCGATTGCAC
TGAGGAGACGGAGCTCTCTCGTGACCTGGTCTCGGAAATCAGGGTGTCATCGCCTCTGTTCTTTTGATCACAGGCCCAGT
TCTCATCANAGGGAGGATGACAGCCAGGTGTGAGGTGGAGAGGGAGGGNCCTCCTTGAGCTCNNCNNTTNNGTTN
Sequence Type genomic DNA
Unitrap ID UNI8333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28375364..28375585 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]


Sequence tag IST14484B8BBF1
Sequence
CACACAGACACAGACAGACAGACACACAAGCAGACAGACACACAGACAAATACATGTAATTTAAAAATTAGAGGGGGCTA
GATTATGTGGTTCATGCCTTTAATCCCAGCGCTCTGGAGGCAGAGGCGGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28375232..28375368 137
 
EST/CDNA Est Name
  BI218278.1


Sequence tag IST14484B8HMF1
Sequence
CACACAGACACAGACAGACAGACACACAAGCAGACAGACACACAGACAAATACATGTAATTTAAAAATTAGAGGGGGCTA
GATTATGTGGTTCATGCCTTTAATCCCAGCGCTCTGGAGGCAGAGGCGGGCAGATCTCTGAATTTGAGGCCAGCCTGGTC
TACAAGTAAGTTCCAGGACAGGGCTACNTAGGGTNAAAAAGTANGGTGTGTGNNGTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28375151..28375368 208
 
EST/CDNA Est Name
  BI218278.1

 
Come back to gene BI218278.1


For any suggestions or comments, please send an email to unitrap@crg.es