Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P104A02
Clone ID P104A02
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P104A02
Sequence
AAAAGAAGAATGTTAAATNNNNAGAAGAAGATGAAANNNTAGAAAAAGACGAAGCTTTAGAAGATGAAGACAGCAAAAAA
GATGATGGCATTTCATTCAGTAGCCAAACTGCTTGGGCAGGCTCAGAAAGAGACTACACATATGAGGAGTTGCTGAACCG
AGTGTTCAACATCATGAGAGAAAAGAATCCAGATATGGTTGCTGGAGAGAAGAGGAAATTTGTTATGAAACCTCCACAGG
TCGTCCGAGTAGGAACCAAGAAAACTTCTTTTGTCAATTTTACAGATATCTGTAAACT
Sequence Type mRNA
Unitrap ID UNI10793

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154703407..154710100 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es