Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D038A05
Clone ID D038A05
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D038A05
Sequence
GACGTTGAGAGAACGAGGAGGAAGGCGAGAAAATGGCGTCCACGG
Sequence Type mRNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4999012..4999056 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


SPLK-Sequence tag 5SD038A05
Sequence
GGATCCGGAGAGGAGACTCTTTTCCAGAAAGAGATTTCTAGCAGCTTTGATCCAGGAGAGGCAGAAAAGCCTCGGCACGC
CACGTTTCTGTAGGCCTGCTCGTTAAGCTAGCCGGCTGATTTATTTCTTGGCCCTATTGAGGCCAGGGGAAGAGACCCAT
AGCGGATTTTGAAAGTCCAGGGCGGGAACTCTAGAATGTGATGGTTATGTTGTGGTCCTTACCGAGAGAATAAGTGTAGC
CTAGCCCTCACCTGCAGTTTAGAATACAGTTAACTGGCACAGTGGCGGGTTTTTTGTTTGTTTTTGTTTTTGCTTCTAGC
GGAATCTAGGGTCTGGTGATGTGGCCTTGGAGGCAGGAGGAGAAAACAAGTGGGGGTGACAGGAAAAGCTCTGGGTTCTT
CATTTGGCT
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997829..4998237 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]


SPLK-Sequence tag 3SD038A05
Sequence
CAGCATCACAATTTGACGACGCAAACCAAGTAGTGACGACACCGGTCGCTTTTGGCACAGGCTACCCAGTGTCCCTAAGA
GAAGACTGAGATACGACTACAGTCCAATATATCCTAGTGGAAAATGGTTTCTTTGGTGGTCCTTTTACCCTTCTCTTAAC
CTCTAAAGCCCAAGAAGGCAATTGCAGTTTTTCTGCTTGATAGATCATTGCCACTTTTTAGTCATCTTTGTTATCAGAAA
ATGTTGATAGCACCCTGAACCAAATTTAAGTTGAAAAGTGTGCTCTGCTATACCCACAGTCCTGGCCCTGCTGAGGGGGA
CTTTATTAAGGGCTTTCCTGAAAAACTTAGTTTTAGACTTTTTTTAAAG
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4997446..4997816 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es