Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999C2
Clone ID IST14999C2
Vector VICTR78
Project tigm

Sequence tag IST14999C2HMR1
Sequence
TGCCTGTGGTGGGATGCTCAGTAATTTTAGCACTTGTGGCACCGAGGCAGGAGAATTGTCAGTTTGAGATCAGCCTGGGC
TACATAATGAGAAACTACCTCCAGAAAAAGGACTATTTCTTTTTACTACTAAATTCTCCTGTTATTTGTTTCTTAAGGTT
GTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTGTTTTTGANACAGGGCCTTTCNTTTACCCCTGTCNGTACTGANNCTTG
CTCTGTANACTGGGTGANCCTNANACTCANANNTN
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106666219..106666487 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


Sequence tag IST14999C2BBF1
Sequence
CCTCGAATCTCAGCACTCAGGAGGCTGCTATTCCAATGTTAGTCTAAGCTATCCAGGAAGTTTCAGGCTCAAAAATAAAA
TCAATAAAATTAGAAAATAATGGCAGCAAAGAAGAAATATTTTTCTGTTCCTAGTTTTCCAAAGGTTTAAACACTTTAGC
CAGTATAAACATACCTTATTTCAAAGTACAGATTTGAAGTATTAGTTGTCTTCCCTGTTGAGTATAACAACTACAAACAC
TTCCTTTCCTTTCAGACTTTCATGCCCTGGGGCTTAAGAAGGTTAACCAAGTCTCCTGGTGTCCCCACACATGGACAGGT
TATCCTCTGGCTAANAGANGGGTCTATTTCTCTTACCGTGANCCCANCNNGAATTANACANNAGTCNNANNTGGGGTTGT
TNCNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106666519..106666918 371
 
EST/CDNA Est Name
  CJ123928.1 - CJ110386.1 - CJ124665.1 - CJ077582.1 - CJ080617.1


Sequence tag IST14999C2HMF1
Sequence
CCTCGAATCTCAGCACTCAGGAGGCTGCTATTCCAATGTTAGTCTAAGCTATCCAGGAAGTTTCAGGCTCAAAAATAAAA
TCAATAAAATTAGAAAATAATGGCAGCAAAGAAGAAATATTTTTCTGTTCCTAGTTTTCCAAAGGTTTAAACACTTTAGC
CAGTATAAACATACCTTATTTCAAAGTACAGATTTGAAGTATTAGTTGTCTTCCCTGTTGAGTATAACAACTACNAACAC
TTCCTTTCCTTTNNNACTTTCATGCCCTGGGGCTTAANAAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106666519..106666802 274
 
EST/CDNA Est Name
  CJ077582.1 - CJ080617.1

 
Come back to gene CJ077582.1 - CJ080617.1


For any suggestions or comments, please send an email to unitrap@crg.es