Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14184E6
Clone ID IST14184E6
Vector VICTR74
Project tigm

Sequence tag IST14184E6HMR1
Sequence
AGCGCCGTAAAGCGCGGTACACCTAACGGATGTAAAGGGTCGGGAGAGGCGTGTACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8973279..8973338 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]


Sequence tag IST14184E6BBF1
Sequence
TCTGTGAAGCAAGGGCGAAAACTGTGGTTCATTTTGTGTTGCACAGTGCCATGCTCCACGCTCCCACTCCTGCAAAGACA
GAGAAGACGCCAACCCCTGGTGGGAAGAAAGTCTAAAGCAACCCTGGGGACCCTTGAGGAAGCGATTTGATTTATTCCAG
TCCCTCCTGGTATTCTGTGCCACATTTATAAACGTCAGGGCCANAATTGAAGTTCCTACTGCCCTGGCNNCTGCTGGTTA
CTGCAGTTGCTCACCCGGGGTTTGCCTCTGGTTGATTNNTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77716960..77717236 271
NO GENE  

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es