Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P147G07
Clone ID P147G07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P147G07
Sequence
CGCGGGTGGGGGGGAGAACTCTTCGGCAGGGCTCTGGCTCTACGGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTT
GCGCAAGATGGCTGCTGCGGGGGCATTCGCGTACTGAGTGCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACG
AAG
Sequence Type mRNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180444615..180444763 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SP147G07
Sequence
CTCAGCCCTGTGTAGGGCCTGGGCGTTGTCTGGGCGCTCATTGCCTCTTGCCAGTGTTGGTGGCCAGGTGTGTGTTAATG
TAGATTGATCTCAACAGTGACTCTTGAGTAAGAGGCCCTGGGTTTGATTGGGAATGTTGTGTATATTTGATTTTCCACAA
AAGGATGCTCCTTGTTACACTTGTCAGGCAAACTCAGTTGTGTAAGGATGACAAACAGCACACAAAAAAGATTGTGTAAT
TGATGACCCCTGCCAGCACTCATGACCAGCACTTTCCTCCTGCCAATCAGTGCATGTGTAGCATCATAATAGCTTGTTGA
GAACGTGTGCTAGGGGACCTGAGGAGAGCTCAGGTAGGTCTTGAAGGCGAGGTGGGATGTCTTCCTGCCTTCTGTCGTTC
GCAGAAGTTTTCTACTGTCAGAAAAGCTCTCTGTACCTCTTCTGGTAGGTATTGTCTTAATAGGCTAAAGAGTCTTAATT
CAGTCAGNNCTGAGCACCTCAAGTAATGATTTCTCTTCAGCATATGAGTACTGTCTGTGCCAGGCTGTACACTTCTGTCA
GNNCAGCATGTTTTACCATGTTACACATCTGCCCT
Sequence Type genomic DNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180435620..180436214 587
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SP147G07
Sequence
CCCTTCGATACNTAGGTNNCTTCGGTTTAACCCAGAAGAGCAAGATTCATGTTGCACTTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es