Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11107E2
Clone ID IST11107E2
Vector VICTR76
Project tigm

Sequence tag IST11107E2HMF1
Sequence
CCTTTATTCTGTTTGCAGGAGATAGATGAGGTAATTTTATAGGTCAGCATTATAGTCCCTTAAAAACTGATAAAGGAGCC
AGGCATGGTTGTGCAAACTAGCCCAGCTCCGTGGCTCATACCTGTAATCCCAGCAGCAACTGGAGAGTCTGAGTCAGGAT
TTCCACGAGGCCAGCCTGGGTTATAAAATAAGACTCTATCTCAAAACAAAATATCTTCAAAATAATTTTACCCCCACGAA
ATCAAGAATCCCAAATGGAGCAAGCATGGTATAGAGTGTAGGGAATGTGCAGTTGCTGGGTGGGGTTTGAACACAGCTAA
GTGACCCCAACAAGTCAGACATCAGGAAAGAACCTACCATCCCTGTCTTAGAACAAAAGTCTGGACCCTTGTCTAGTCTG
GTGGGTGTTGTCAGCAATGTGCACACTCANGGTGGCTCCCTGGANNANGANCCCTGGGTGGGGAANNNTGGGGTTGNNGC
TNCATTTCCTANANCTTTGTGTATCTCCCCNNGN

Sequence Type genomic DNA
Unitrap ID UNI27761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43172641..43173150 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]


Sequence tag IST11107E2BBF1
Sequence
CCTTTATTCTGTTTGCAGGAGATAGATGAGGTAATTTTATAGGTCAGCATTATAGTCCCTTAAAAACTGATAAAGGAGCC
AGGCATGGTTGTGCAAACTAGCCCAGCTCCGTGGCTCATACCTGTAATCCCAGCAGCAACTGGAGAGTCTGAGTCAGGAT
TTCCACGAGGCCAGCCTGGGTTATAAAATAAGACTCTATCTCAAAACAAAATATCTTCAAAATAATTTTACCCCCACGAA
ATCAAGAATCCCAAATGGAGCAAGCATGGTATAGAGTGTAGGGAATGTGCAGTTGCTGGGTGGGGTTTGAACACAGCTAA
GTGACCCCAACAAGTCAGACATCAGGAAAGAACCTACCATCCCTGTCTTAGAACAAAAGTCTGGACCCTTGTCTAGTCTG
GTGGGTGTTGTCAGCAATGTGCACACTCAGGGTGGCTCCCTGGATNANGAGCCCTGGGTGGGGAANGCTGGGGTNNNNCT
CCATTTCCTANAGCTTTGTGTATCTCCCCAGGGTGCNCACTTTTGANTCTACAGTGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI27761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 43172641..43173181 517
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023915 (Tnfrsf21) NM_178589 tumor necrosis factor receptor superfamily, member 21 Gene [Source:MGI Symbol;Acc:MGI:2151075]

 
Come back to gene ENSMUSG00000023915


For any suggestions or comments, please send an email to unitrap@crg.es