Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14632B3
Clone ID IST14632B3
Vector VICTR74
Project tigm

Sequence tag IST14632B3HMF1
Sequence
GTCCCGGGTCTCCCTTAACTCCTGGGACTCTGAACCTTGGAGGCGAGGCGCCAGGTAATGGCTGAGGCAGGATTGGGGCG
GGGAAACCGAGGCACCCGCCCTCTGCAACTCTGGACTCTGTAGGGCAGGCAGGGAGCCGTGGGCGAAGGCTGGCCCGCGC
CGCCTCTTCCCAACTCGTGCAGCCCGGAGCGACCCGCCGCGAATCCGCAGCTCANTTGGGTAGCACAGCTTGTCCTGGAC
CCACCGCCAAGGTGANACTCGCCCGCCNNGCCCTTGCTCTGCCTCCCACGGGGGAGGGGGTCTCTGTCTGNTNNNGCN
Sequence Type genomic DNA
Unitrap ID UNI27076

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21936122..21936431 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001348 (Acp5) NM_007388 acid phosphatase 5, tartrate resistant Gene [Source:MGI Symbol;Acc:MGI:87883]

 
Come back to gene ENSMUSG00000001348


For any suggestions or comments, please send an email to unitrap@crg.es