Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14740G11
Clone ID IST14740G11
Vector VICTR76
Project tigm

Sequence tag IST14740G11HMF1
Sequence
AGATTAAGACTAGTCTGCTATGTATTTAGCGTGTGTATGTTCGTGTGTCTTGTGTGTATGGAGGGTAGAGGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722521..69722596 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]


Sequence tag IST14740G11BBF1
Sequence
AGATTAAGACTAGTCTGCTATGTATTTAGCGTGTGTATGTTCGTGTGTCTTGTGTGTATGGAGGGTAGAGGTCAACATAG
GGTGTTTTTCTCAGTTGCTCTCCATACGTTTGAGCCAGGGTCTTACTGTATTTAGAGCTTACCCATTCACCTAAACTGGC
TGACCAGCAAGCCTCAGAGATCCTTCTGTCCTGTGTTCCTAGCACTGGGTTTATAATCATGAACACCTGACCTTTTACAT
GGCTGCTGGGTATATGAGCTCAGGTTCTAATGCTTTCTGGGTAAGTACAGTACACACTGAGCCAGCTACTACCACACAAG
TCCCTGGTTTTCTCATTGTGACTTTTTACAGCTTCTGGTTGTAAGGTTTGTAATGAAACCTAATTTTCTTTTAAAGATTT
ATTTATTTATTGTATGTAAGTATGCTGTANCTGTCTTCANACACTCCAGAANANGGCGCCNGANCTG
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69722131..69722596 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es