Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14161C2
Clone ID IST14161C2
Vector VICTR74
Project tigm

Sequence tag IST14161C2HMR1
Sequence
CTACCATTTGTTGTTGTTGTTCCTTTTAGAAAAGCAGGT
Sequence Type genomic DNA
Unitrap ID UNI29489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707381..165707420 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14161C2HMF1
Sequence
GTAGAAANNNCCAGANNNCNNTACTCAGGCCACTGCAANNNNNNNTCTTTAACCTTTCCCCTAAATCTGCTGGCTTAAGA
GAACAGGAAGAAAGGGGAACCCCGTTGGGCTAATCTGTGGGCCTGCACTAAGATCCCACCCGGTCCAACTGCAATGCAGA
CTTTTTTTTTTATTTCCCCCTTTATTAACTGGAAAAAAATGCTACTTCAAAAGCAATTAACTTTTTACCAACCCCNGGCC
CTGNGGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14161C2BBF1
Sequence
GTAGAAATTTCCAGAAGTCCTTACTCAGGCCACTGCAAATGCCAATCTTTAACCTTTCCCCTAAATCTGCTGGCTTAAGA
GAACAGGAAGAAAGGGGAACCCCGTTGGGCTAATCTGTGGGCCTGCACTAAGATCCCACCCGGTCCAACTGCAATGCAGA
CTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707417..165707586 170
 
EST/CDNA Est Name
  CJ169184.1

 
Come back to gene CJ169184.1


For any suggestions or comments, please send an email to unitrap@crg.es