Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003A10
Clone ID D003A10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D003A10
Sequence
CGCCGTGGTCCCCGCCGTGGTGGCCGTTAAACGGTCTCAGAGCGGAGCTATCGGTTGTCTGCGGCCGTAGTGAGCTTTGC
TTCGTTTCCTGAAGATGGAGGGTCCTTTGTCCGTGTTCGGGGACCGCAGCACTGGGGAGNNGGTCCGCTCCCAGAATG
Sequence Type mRNA
Unitrap ID UNI10798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13109338..13109495 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]


SPLK-Sequence tag 5SD003A10
Sequence
AAATAGTAATTACAGACTTTAGATTTTAGCAAATCATAGGTAGTTGATGTGTCATAGTGTAGGTGTTGTTCTAATTTGTT
GGGGCTGTTCCTCGGCACTTATGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD003A10
Sequence
CTCTTGATTGCCTTGATAAAAGTACATTGCTTTAAATTTCAAAAAAAAATCTTTGGTAAAGACTTTGTTTTTACCTGAGA
ATGGATGGAATCCTAGAGCTTGGTTTCTGTGTTGACCACTTATTCCTTCATATTTCTTAGGATGTAACCATTACTAACGA
TGGCGCCACCATCCTGAAGTTACTGGAGGTAGAACATCCCGCAGCCAAAGTTCTGTGAGAGCTGGCTGACCTGCTAGACA
AAGAAGTTGGAGATGGAACTACCTCAGTGGTGAGACGCTACCAGGAAATGGCTAGAGAATAGTCAATTTATTAGAGTTGA
ATCCATGAGAGAGACATACTCTAGTCCAGAAATAAGTCACCTTTTAAGGCAGACTCACAAACTTTTGAAAACTAACCATT
GTAACTAGTTTGTGTAATTTAAGTAAGGGAAGAACTTAAGGTGATTAAATAAATACTAGCTTGTAAGAACCACTGTTGTC
TCGTGGNATTTGTAGCCATATTTAAACCTACTTAGCCATGATGACGTTCTTGTAGAAAAAGATACCAGGATTGGACTTTT
TTCTTTGTTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es