Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13639C12
Clone ID IST13639C12
Vector VICTR74
Project tigm

Sequence tag IST13639C12HMR1
Sequence
GTTTNNCTGTGATTTTGAAATACATAAATAAACTTGGTCTTGGGAGATCAGTGCTAAAATATGTACAGGTAAAATGATAA
CNAGACCTGTAGCATGTGCCTAAGAGCAAACCCTGGGGTCTGTACACATGGCCGTGTGTGTGTCTCACAAGCATGTGCAA
GCGACCCACCTGCTTTTGCTTTAGGAGTGCTGGGATTAAAGGATAAGCTCTCACACCTGGTTTCCTCTTATTTTTTAAAT
TACGTGTAAGTGTGTGTCTGTACCCATGTGATACCTCCTCTCACTCACCCAGGANCTTGTAGATTCTCCNNNNCCAGAGA
GCCCGCCTGCCTCCAGGGTTACAGAT
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57289161..57289506 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es