Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13378H8
Clone ID IST13378H8
Vector VICTR74
Project tigm

Sequence tag IST13378H8HMF1
Sequence
CTATGAAGCCAACCACGTGCGTGAGTGCCTGCGTAAAGGTGAGGAGGGGCGGAGGGCTGCACTGGGGCTACATCTGAGGG
GACTGTTGTGTTCTAGCCTGCCCTGAAACGCAAGTAGCTATTTANAACTACATCTCCCAGGATTCANAGAGATAGCCACC
TTCTCAAACTACCCTGCCCATGCCGCAAAGACTTCTGGGAATTAATAGTCCTCTTGCTGTCTGATGCGTGCGTTTTANAC
AAGTCTTCCTGTGGTCACTCTTCCCAGGTCTTAAGGAGAGTCCTGTAGTTCCTCTGGCAGAGAGTGC
Sequence Type genomic DNA
Unitrap ID UNI30801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52730707..52731012 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es