Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D006C09
Clone ID D006C09
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D006C09
Sequence
CACTCTGTAGCTCCGGCTGCTGTGGAATTTACAGCATAGCCCAGAACTCGAGGCGTCTGCTTAACCCGGCTTCTCAAATG
TTGGCCTATAGGAAGTTTGGTGAGCGGCCTCCACCCAAACGACTCACTAG
Sequence Type mRNA
Unitrap ID UNI2686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53947052..54018660 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


SPLK-Sequence tag 5SD006C09
Sequence
GATCTCATTAAAACTCTTAACATTTTAGTAATCTTTTTACATCAGAGATAGCCCGGGAGACTAGCATATCTGCTTCAGGA
GAATTCGGGTAAGCTTTGCTTCTCTCCTGAAGTGCTTCTGCTTTAGGAAAACAATGTCTTATTTGGGAAAAAAAATATTT
TAAGAGGTTTGTGTCCACTGTGTTGTAGGGGGAGTATAATGTGGGGGCCATGTCTTCTTTTAAGGAATGTTCAAAGCCTA
CCCTG
Sequence Type genomic DNA
Unitrap ID UNI30301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54023029..54023273 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]


SPLK-Sequence tag 3SD006C09
Sequence
AGCAGTATTGGTGGGAGAGTCTCTAATGAGGCCTGGGGAAATCTTTTTTTTTTAAAAAGGATTAATTAATTTACTTTGGG
AG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es