Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12409C10
Clone ID IST12409C10
Vector VICTR76
Project tigm

Sequence tag IST12409C10BBF1
Sequence
GGACTGGGGAGGCAGTGCTGGAGAAGGGACCCCAAGTTGGGAGCAGACCGTAGCCACTGAGTGGGAAAGCCATGTGCAGC
AGAGTTCCTGGACCTTGGTTTTGATTTGAGGTGAATGGAAGAAATGAAGGAAGAAAGCAGAAGAGAGTTAGTTTAGAGTG
AAGAGGTGGGAAAGAGGCCTGCCTGAGCGCGTGGGAAGGGGGTGCTAACTCATTCGTCATCAATGGGGTCCCCACACCTC
CACAGGGCTCACATGAGACCACTGGGAGACACAGATGTTTACGATTCATAGCGGTGGGAGAATTACAGTTATGATGTCTC
AACAAAATAATTTTGTGGTGGGGGANGGTCACCGCAACATGAGAAACTGCACTAAAAGGGTCNCAGCCTCNGGAAGGTTG
AGAANCNCAGTGTTAGCTGAATCTCTGTGCNNANCTGANCTGGACCGAGCTGTGGGGTANCN
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99325125..99325583 441
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]


Sequence tag IST12409C10HMF1
Sequence
GGACTGGGGAGGCAGTGCTGGAGAAGGGACCCCAAGTTGGGAGCANANNGNANCCACTGANTGGGAAAGCCNNGTGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es