Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D010E07
Clone ID D010E07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D010E07
Sequence
CCGTCCAGATTGTCACCGACGCTGCCGTTGTTGCCGCTGCTACTGCTCCTGCTTCAGGAAACAG
Sequence Type mRNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20334564..20334627 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]


SPLK-Sequence tag 3SD010E07
Sequence
ACACCTGTGCATTGACACCTCACCCCTGCCCCAANNNTATGTAAAAGCAGTAACTAAACAAAACAAACAAACATAAGCCA
CAGTTCATCTCACTCTGAACAACCGTTGTTCTTGTATTCAGAATTAGAGACTTAGTCTGGAGGTCTTGGGGCTGTGAGAT
TCTTGTCATTTGTATGTTTTCATTTGTGAAGGGCGTCCCTGGATAATGAAGGTTAACCTGGAATTCTCCGGCCCCAAACA
TCCTTATGCCTCTGTCTCCTTAGTTTTGGAATTATGACTGAAGGCTGTTGAGCCTGGTTCACTGATACCTCCTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es