Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11688A3
Clone ID IST11688A3
Vector VICTR76
Project tigm

Sequence tag IST11688A3HMF1
Sequence
GCGGCGCGTAGGAGGCGGTGAGGAGCCCGGAACCCGGGGGCGCGTCCGGACGGCCCTAGATCCCCCGAGCCCCATATTGC
TTCTTTTTGTATGCCTTCCCATCACCCTGCTACTTCTGGCCTCGCAACGGGCTCTTTGTCCTCGTGGTGGTGGCCTCTGG
CTACAGCCTCCCAGCGGCAGATTCACGAGTCGCTGCGGCCCTTGTCTGTGGGGTTCCTGAATCTCGCCGGGCTTANAAAG
GCTGAAGCTGGGTGCTGTCTTCGGTCTTGTCCGCTCCCAGCCGCCCCTTCTCCCTTGGCGGTTCGGGGTGGTCAATGCTT
TCNTCTCCTTCCTGCANTGCGCAGGGCTNNCNAGGCAGGTAGGGGGACNAAATGCATCCCANCCTGTAAAAAANCANCCT
GTTGCCNCACTGCTNNTTTTTNANGTTGGAANCAATACGATGGGCANATCGTCCTGTATTCCTTCCTTGNCCTCNNNAN
Sequence Type genomic DNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8972633..8973106 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es