Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10987B11
Clone ID IST10987B11
Vector VICTR76
Project tigm

Sequence tag IST10987B11HMR1
Sequence
ACTCACATTTAGAAATCCTCTGCTTCACATGTCATAGTAGCTGGGATTGTAGGCGTG
Sequence Type genomic DNA
Unitrap ID UNI11950

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14165703..14165759 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022678 (Nde1) NP_001107557 nuclear distribution gene E homolog 1 (A nidulans) Gene [Source:MGI (curated);Acc:Nde1-006]


Sequence tag IST10987B11HMF1
Sequence
AGTCCNATCTGGACAACTTANAAAGACCNANACTCTTATNTNAAAAATAAAATTGAAACAAAGCACTAGGTAACCAGCTC
AGGCAGGGGAGACCTCGGCTAAGGCACATGGGTTTAATTCCAAGTCCTATCAAAAACCAAGAGAATATGGTGTGCATTTA
TATTACTCATGTGTTGGTAACTTGCTTTTNAATGCCTTGGTGCTTGCTATCTTACGCCTNTGTGGACCAATTCAGGGACC
ACACAAATATGTTTGGTANGGCAGGGGAGATGGCTNNNCTANTAAAAGGCTCTCATACNNNNNCNANAGCCTGAGTTCAA
ATACNAAACACCCATGTAAAAAGCTGCACACTGNTGTTCTACAATCCCAGTGCTANGTGTGGGGANACAGAGATAGGCAA
GATCCCTAAAGTTCAGCGGCCNGCCNACCTANCCCAACTAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022678


For any suggestions or comments, please send an email to unitrap@crg.es