Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D018B03
Clone ID D018B03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D018B03
Sequence
TCTCGCGAGGACGGACGCCATTATCGCAGCTCCCCGACAAACACCACGAGAATTCCGCAGCCCACACG
Sequence Type mRNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124474481..124474548 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]


SPLK-Sequence tag 5SD018B03
Sequence
GACTGAGTTTCTGGTACTAGGTATGTTCTCTTTCAGCTGTGTCTACTCTGTCTTTCAAGTTCCTCCTCAGAGACCTTGGA
AAGGGGCGGGCACAGAGGCCTGGGGGTGCTTAGGGCTGCTGCACCTGTGTGACAGCCCACTGCCCAGCTTTCCGCTGCTG
CTAACGACCTGCCGGCNNNTTTTGAGTGAGTCTTTGTACAGTAAGTGCATATGCTGGCAGGTTCCTGTGTCCAGGGAGGA
CTCCCAGAGTCACNNCAAGGCCCCTGCGAGCCACTGGGGCCCCGTGGCGTGTCAGGTATCAATGTTGCCAGTTATCCAGC
AGGTGAAACACCTGCCCATGCTTTGGCCTTTCCTTGTTTGTTTGTTTGCTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124493232..124493606 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es