Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14450F4
Clone ID IST14450F4
Vector VICTR74
Project tigm

Sequence tag IST14450F4HMR1
Sequence
NCATGGTGCCNCCGTTCCTGGAACTTGGAGCCTCTGTTTCCCCATCTATAAATTGGGAATCAGCAAAGGCCTACCGGCAG
GGTTGGAAGTCACTGGCTATTAGAGAACAGGATGCTTGCCCTCTGATATCCTTTGACCTCTGCCTGGCCCTGGGCAACTT
TCCAGCCTTTGCTTCCCTTGGCTCCAGGCC
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250081..100250269 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST14450F4HMF2
Sequence
TGCTCAGTGCTGAGTCTGTCTTACTTGCAGACTGGGGTTTAGTTCACTTCTGAGAGTCTGGGAGAAACTGAGCCCTCTGA
CCAAGGGGAGGAAGGGGAAGGTAAGGATGAGGGTGATCACAGGTGGCGGTCCTCCCCACCTATGCNTTGGTCAGATTANG
GTCANATTAGGGTCCCAGCTCTTCCATATATGCTGGGAATCTCTGGGTGTTTTTGCNNNNTTTTGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100250268..100250494 209
 
EST/CDNA Est Name
  CN696758.1 - CD554879.1 - BI557474.1


Sequence tag IST14450F4BBF1
Sequence
TTTTGCCTGCAATAACTATAGATAGTGACTGTGGCTGGAATGTCCCCTGGCTTAAAGTCTGGTTCACAACAAAAGACGCC
CAGATATAGCAAGAACGATTCCTGATTGTTAGTTTGGGTGACTGATTGATTGATTGATTGATTGGTGGATGGTGTATGTG
TGTGTGAGTGTGCATGTGTGTTTGTGTGTATGTATGTATGTGTGTGTATGCCTGTATGTGTGTGTGTGTTTATGGGGAGG
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 118898499..118898737 237
NO GENE  

 
Come back to gene CN696758.1 - CD554879.1 - BI557474.1


For any suggestions or comments, please send an email to unitrap@crg.es