Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11531F6
Clone ID IST11531F6
Vector VICTR76
Project tigm

Sequence tag IST11531F6HMR1
Sequence
CCCCACCGTCAATGTAGTATTTTTGATCCATCTTGCTTATTTTCCATTATCACTGTTTTAAAAACCTCTCTGAGCTAACC
ACACTCCTAAGATTGTCC
Sequence Type genomic DNA
Unitrap ID UNI7975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118006877..118006973 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039163 (Cmc1) NM_026442 COX assembly mitochondrial protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915149]


Sequence tag IST11531F6HMF1
Sequence
ACACGTTAGAGTCATTTTANAAGAAGGAAGAGCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 91085320..91085355 34
NO GENE  


Sequence tag IST11531F6BBF1
Sequence
CAATTTTGTGGTTATTGTGTTTAGCAAATGATAAAGTGTGTTTTNATCTTATAATTATAGCTATAAAAGGTAAAATTCTT
TGATTGATCTAAATTTATAAGATTCGTGTAGCCNCTTCATTTGGTTTTTGATTGGTCTTAAAGGTATTAATATGATCTGC
ATATCTTGGTCATAGAGAATTGNCTTATNANTNTTTGGGTATGATTAAAAAGGTATAACACTGGTTACAAAGTTAGCTTT
ANTANTAACACAGGGCTANAGTCATTTTCAAACNANANCACCTGGCATAAACCAGCCCANANAACTANTCTNCTAAAGAT
ACTTNTNAATTGAGATAATATTTTATGTAATTCTTATCCTAAAAAGTANACTTATAGAGATAAGATTTTAAAACAATGTC
TCCTTAATGGAACATTAAAATTTACACTGNNNTGCATTCATGANNNGNCAGCCAAACTTCGTAACGTGATANNGATGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039163


For any suggestions or comments, please send an email to unitrap@crg.es