Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15061D10
Clone ID IST15061D10
Vector VICTR80
Project tigm

Sequence tag IST15061D10HMR1
Sequence
TTNAACACAAAGCCNGTGCTTTATTTTATTAGCAGCCATATAACAGCAAAGTAATGGCCTCAGGAAACTTTACTATCTAA
GAATGAGCTGGATCTGAAGAAAATGGGAAGGACACAGGGATAGGACAAGGAGGGAGAACAACAGTGTTTGGGTAAAAATA
CAATTTCTTGTTGTAATCATTGTTTCGTTGTTTTTTGTTGTTGTTGTTGTTGTTGTTGGACATAATGTTTTGTTTTAAGA
CAGGGTCTCACTATATATCCTTGGCTCTCCTGGAACTCACTATGTAGACCAGCCTGGCCTCAAATTTACAGAGATACAGC
TGCCTCTCAAGCCTAGGGTTAAAAGTTGTGAACCAAATACATCTTTCAATTTGGGTGAGAANGAAGGACAGTACTGGGAT
TGAATTTANNGCCTCATTANTACTAGACAGGTGTTTGGTTTTN
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108183629..108184070 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]


Sequence tag IST15061D10BBF1
Sequence
GAACAATGCCTCAGAATAGTTGGGTATGGTGATGTACACTGTAATCCTAACCATTCAGGAGCAAGAGGCAGATTAGGAGA
AACTTAAAGTCAGTCTTGGGTATATAGCAACTTCAATGCTAGCCTGAGCTATTTTAAAAAACTGTCATGCATCTTTTTAA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACAAACAAACAAACAAACAAACAAACATACATACA
TTCTATCCAGGNCAGGATANAATAGGGAGACTCANAAGACAAAGGGAACTAAGGAAAATATAAGCCTAAGGAAGTTCATG
AAATTTAATGGCTGAANAACCTTAGAAAGTTAAAAGTTCTACAAACTCCCTCTTCANGCACTTCTATACNNAGCGCACAN
TTANNGGGGTGTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108183216..108183631 380
NO GENE  

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es