Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091C5
Clone ID IST10091C5
Vector VICTR75
Project tigm

Sequence tag IST10091C5BBR1
Sequence
CACAGAGGTATAAATTAAAAATAAGCTTTGTCTGGGCATGGTGGCGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGG
CAGGTGGATTTCTGAGGCCAGCCTGGTCTGCAGAGTGAGTTCTAGGTCAGTCAGGCCTACACAGAGAAACCCTGTCTCGA
AAAACCAAAATAAAAAATAAAAAAAAATAAGCTTTGGAGCTGGGGATGTGGCTTGGTGGTAGATTAATTGTGCACGGACC
CCTCCATCACCCCCTGCCACCACCAAAAATACGCAGCCCGGAGGAAGGGCTGTGGAGTGGGGGTGGGGAGTGCCTAGGTA
GAGAGGAGGTTTCAGTTTGCTTATTTAGAATCCTTGGTGACCTTGAGTAGCTGCATGCTGCACACCTCATCCCTGGCAGT
GCACGTCCACAAACAGCAGGGACCAGAAGAGCCTGTCCCTGTCTTCCTTAAGTTGTTGGTCCTTGTTTTCTTTTCTTTTT
TTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI6070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29689187..29689679 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es