Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14395G7
Clone ID IST14395G7
Vector VICTR74
Project tigm

Sequence tag IST14395G7HMR1
Sequence
GAATGGGGACCTCTCCTGAATTCTAGAATCTGGATTTAGGGTGGGAGTTTCCTCTCCTCCCCAGATCTGCCGATCCAGCT
ATATATACCTCAGGACTCAGATCTATAAGGAACGTGTTTGGACAAAGCAAGCCTGAGCAGTGGAGGGACCTAGCTAGAAA
AGAGAAACTTACCTCTTCTGAGGAAAGAGCACAGAAN
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025166..71025361 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST14395G7HMF1
Sequence
ATTCCACTCTCCCCACACGTGAGCTCTGAAAGAATTCTGCAGACATTGCCCACCAGTGGGTAGACAGATGCTCTCCTAGC
CTCAGAAAGACCAACTAGCTGTATGGAGACAAGACTCCCAGGAGCATACATGCAGAAGACAGAAGAGCTCTGCCCAACAC
ATGGCTGCTGACAGAACTGCACATGGGTGCACACAGGGACTCTGCCGCCCTCCTTGCCAGAGCACTCGCCCACTCTCCCT
GCCAGACCCCCACACAATGACACATGGTGCTAAGGACACCTACTTGCACCCACCCACTGATCCTCCCCTTGGCACCCGTC
ATCTGTGCTCACAGCTCCCTGGCATGGCCTGCTGAACCCATCCCTGTTCTGAGCACGTGAACCCCAATACTCCCAGTGCC
CTCACCTGANCCATCCCCACATCCCTCCACTCCCACTGCACCGTTGCCTTGCTTGTCTTANACCTACAGCCTGGCANNCA
NTCTTCTGGGAGNANANNCACNNNGTGCCTGCCCAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025358..71025875 490
 
EST/CDNA Est Name
  BY370115.1 - CA749923.1 - CX243464.1 - DN175753.1 - CK789192.1 - CJ070069.1 - DN173117.1 - BF783783.1 - BF781323.1 - BI144119.1 - BF471156.1 - BY244261.1 - CF171216.1 - AI427373.1 - CF171266.1 - BY261031.1 - BY248088.1 - BY270037.1 - BY291741.1 - BY260120

 
Come back to gene BY370115.1 - CA749923.1 - CX243464.1 - DN175753.1 - CK789192.1 - CJ070069.1 - DN173117.1 - BF783783.1 - BF781323.1 - BI144119.1 - BF471156.1 - BY244261.1 - CF171216.1 - AI427373.1 - CF171266.1 - BY261031.1 - BY248088.1 - BY270037.1 - BY291741.1 - BY260120


For any suggestions or comments, please send an email to unitrap@crg.es