Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P107C02
Clone ID P107C02
Vector ROSAbetageo0
Project ggtc

Sequence tag P107C02
Sequence
ACNNGACATCGAACAANNACCCNNACCCCNNACNNCCCCACACCCCACGACACAGCACAACAAGCAACAAACGCACCACC
ATAAAAAAACCACCANNAGCAACACACANNAGCCCGCAAAACCACGACACCAACACCCAAGCAAANNNCCACACGCAAAA
CACCAAACACACANNACANNCCACTAACAAACCCACNNACCGAAACCCGAAACCACACCAAAAAAAAGAACAACCNNNAC
AACANNACAANNACCCAACAAATTATCCCTCCCACCAACACAAGCGGCGCAGAACTCTACNNNAAGGGCTCTGGCTCTCC
GGGTTGGCGCGAGAGTCAAAAGGCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGGCATTCGCGTACTGATTTCTA
GCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAGGAGCTTGTTTAAGAGGCAGTCCCCACTGTCCCTTTGGTTG
TTCGAAGCTCCGGAATCTTCTCATTGATGAACTGTGACTGACAACAGTGGGGTGAGGCTTGGCCGTCTGCTTGACCTGGC
CCCAGGTCTATAATTTTATGTAGGATTTCCAGCCAAAGGTTTCCAAGCTTTCAGTTTTGGGACAG
Sequence Type mRNA
Unitrap ID UNI351

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180426569..180444767 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 5SP107C02
Sequence
AGGGAAACGGAGACATGGGCATACTTGGATGGTAATATGCCTTGAAGCTGTTGTTTAGATCAATACAGTGGAGTCAGCTG
TCTCCAGGAGTCTGGCAGCTGTTCTTTTTACTTGGTGTCCACAGTAGGACTCCATGCTCAGTTGGTTCAGTGTGGAACAC
AGTCTCCCAGTCCAGGCTTTGGACGAGAATACAAAAGGCAGCACCAGAGCCCCAGACACACTTGGCCAGACTTCCTGTGG
GGCAGGCCCAGAGGTGGCACACATCAC
Sequence Type genomic DNA
Unitrap ID UNI29527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180424791..180425057 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es