Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15049D3
Clone ID IST15049D3
Vector VICTR80
Project tigm

Sequence tag IST15049D3HMR1
Sequence
TTACAAAGATCATGTATGAATCCCAGACATTGGAACAAGAAGCTGTGAAGTTGAAGTTACATTGGAGACCCCAAGATGTT
CGAGATGCCAAAGCCATAGGATATCTGCTGAGAAAAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507170..108507290 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST15049D3HMF1
Sequence
GTAGCATGCTAGGTAGGCTATGGCTGACTTCACTCCACAGCTGCTGCTGTTCTTGGTGATCATGGTGATGGTACTGGTAT
CTCCAATACACAAGTGTCTTCCGTTGCAACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTG
CATGGTCCTTTCAGTCCTGGGTCTTCAAATGTCACTAAGGCTGTACCTTCAACGATGGCCTCTCCTAGCCTCTCACAGTG
CCTAACCTCAGCTGCTCTCCATGACCCCTTCATAACTTCAAAATCAGTCCACCTGGGTATCTCTTACACACTACCAATTC
CAGCTGAAACATGAGCTACAACCTTGGCTATTAATGGAACACAGGCTCCTTTGTGCTCTCTGAAAACACTTCCCAGATTT
CACTTCNATGATGCTGGTCTCTTCTTAATCACCGTGAACTTCCTANCTCTAGCNNNCCAGCATNNATTGTCCCAGTNNTC
TTGTCCCTTCTATTGACNNANACCAGANCCACATACATNGGCCNAAGCTGNCNACCNANTTCTGCTGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506627..108507172 507
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST15049D3BBF1
Sequence
GTAGCATGCTAGGTAGGCTATGGCTGACTTCACTCCACAGCTGCTGCTGTTCTTGGTGATCATGGTGATGGTACTGGTAT
CTCCAATACACAAGTGTCTTCCGTTGCAACTAGGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTG
CATGGTCCTTTCANTCCTGGGTCTTCAAATGTCACTAAGGCTGTACCTTCAACGATGGCCTCTCCTANCCTCTCACAGTG
CCTAACCTCANCTGCTCTCCATGACCCCTTCATAACTTCAAAATCANTCCANCTGGGTATCTCTTACACACTACCNATTC
CNNCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506846..108507172 311
NO GENE  

 
Come back to gene CF895920.1


For any suggestions or comments, please send an email to unitrap@crg.es