Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DC0127
Clone ID DC0127
Vector pGT1lxr
Project sanger

Sequence tag DC0127
Sequence
CAATAACCGGAACCAATGAACGCGGCGGCGAGCCGAGCTTCGCGGGCCGCCGGTGAAGGGAGCGGGTCAGCACCCGGCGG
GAGTCCGCTTCCGAGGCGGCCGGGCCCCGGGCAGCTGGCGGTGAGCGAGTGGCCGGCGGCTCCTGTGAGCGCTCCTCCCG
CCGTGGCACCGGGCCGGGCCTCGGGCCGCCCTCTCCCGGCGGCGCTGGGCAGCAATGCTGCTCTTCGGGTTGTTGGTGGC
CGGCGTGGCGGACGGATGCGATCTGGTGCCCCGGCACCTCCGCGGGCGGCGCGCGTCGGGATCGGCCGGAGCGGCGGCGT
CTCCTTCGGCTGCGGCTGCGGGCGAGCGCCAGGCGCTGCTGACAG
Sequence Type mRNA
Unitrap ID UNI1310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 54389911..54390273 360
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039156 (Stim2) NM_001081103 stromal interaction molecule 2 Gene [Source:MGI (curated);Acc:Stim2-001]

 
Come back to gene ENSMUSG00000039156


For any suggestions or comments, please send an email to unitrap@crg.es