Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P134E10
Clone ID P134E10
Vector ROSAbetageo0
Project ggtc

Sequence tag P134E10
Sequence
CAGAGCCCCCACAGACCACACTCCCGACACACCCAAATATAAACATCCCCTCCCACTGCACCACCACAAAAATAGCCCCC
ACNNCTTGAAANNGNNGTGAAGAAACTGAAGGCTNAGAGGAAGAGGCCAGAGAAAATGCCAAGGCTGAAGAAACANNAAA
TGAATCAGTTCTTGAAAAAAAGTCTCTTCAAGAAAATGAAGAGGAGGAGATAGGGAATTTGGAACTTGCCTGGGATATGC
TGGATTTAGCCAAGATCATTTTTAAGAGGCAAGAAACAAAAGAAGCCCAGCTTTATGCTGCACAAGCCCATCTTAAACTT
GGAGAAGTTAGTGTTGAATCTGAGAATTATATCCAAGCTGTGGAGGAGTTTCAGGCTTGCCTAAGCCTGCAAGAACAATA
TTTGGAAGCTCACGATCGTCTCCTTGCAGAGACTCACTACCAATTAGGTTTGGCCTATGGTTACAACTCTCAGTATGATG
AAGCAGTAGCACAGTTTGGCAAATCTATCGATGTCATTGAAAAGAGAATGGCTGTACTCCATGAGCAGATGAAGGAGGCC
GAAGGATCGTTTACTGAATATGAGAAAGAAATTGAGGAGCTGAAAGAACTGCTACCTGAAATTCGAGAGAAGATAGAAGA
CGCAAAGGAATCTCAGCGGAGTGGGAATGTAGCCGAACTGGCACTGAAAGCTACTCTGGTGGAGAGCTCTACTTCCGGTT
TCACTCCTAGTGGAGCTGGTGCCTCAGTATCCATG
Sequence Type mRNA
Unitrap ID UNI10814

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116275493..116278373 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es