Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11654D3
Clone ID IST11654D3
Vector VICTR76
Project tigm

Sequence tag IST11654D3HMR1
Sequence
AAATTNNCCNNCATACTGATAAGTTACTTGGTTACTGTAGGGGAGCAAAGTTTAGTGACATTCAAGATTCAAGGAACTGA
GGATAGGCTGGCAGGGTGAAGGTGATTAACTGCCAAACCTGAAGGCCTGAGTTCTGATCACAAGATGGTACAAGGGGAGA
GTATGTTANAAACAGGATATTTCTTTGAATTTGAGGCCNNCCAAGTACCTTCATAGTGAGGTACTGCGTANACTGTAAAC
AGTGGCACTGGGGTATCTCANTTC
Sequence Type genomic DNA
Unitrap ID UNI13400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127508403..127508665 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es