Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11573C2
Clone ID IST11573C2
Vector VICTR76
Project tigm

Sequence tag IST11573C2BBF1
Sequence
CCAGCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI6991 UNI29416 UNI30839 UNI30840 UNI30841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3491912..3491955 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38507026..38507069 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24924569..24924612 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11263870..11263913 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 38101170..38101213 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37024558..37024601 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3520402..3520445 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5406636..5406679 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21502975..21503018 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032187 (Smarca4) NM_011417 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 Gene [Source:MGI Symbol;Acc:MGI:88192]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 31526388..31526431 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5934066..5934109 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019763 (Rmnd1) NM_025343 required for meiotic nuclear division 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rmnd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3519309..3519352 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004565 (Pnpla6) NM_015801 patatin-like phospholipase domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1354723]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29817693..29817736 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029772 (Ahcyl2) NM_021414 S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI (curated);Acc:Ahcyl2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16431945..16431988 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18990771..18990814 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040003 (Magi2) NM_015823 membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI (curated);Acc:Magi2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43636239..43636282 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9230293..9230336 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45908448..45908491 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 11497788..11497831 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16975923..16975966 44
NO GENE  


Sequence tag IST11573C2HMF2
Sequence
CCANCAACCACATGGTGGCTCACAACCATCCATAACAAGATCTGACTCCCTCTTCTGGTGTGTCTGAANACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTAAAAAAATGCATAATAAATGAAAAATAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040003


For any suggestions or comments, please send an email to unitrap@crg.es