Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12230F9
Clone ID IST12230F9
Vector VICTR76
Project tigm

Sequence tag IST12230F9BBF1
Sequence
CCCCTGGGCCCTGGCTGGTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGGTGGGGGCGCGCAGCTTGCT
CTGGAGATGGCAGCCGGAAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTAGGTGAGGTCCCATAAGGTT
CTAGCATGCAGGACCGCCAGGCTCTAAGCTTTTCCCTTANAGCTTTAACCTGGTTTANTACCTTCCCACTGCACATTGCA
CAGTGGAGTGGTCCCCACCCCTTCAAGACNCCAGTGGTATGGCCCTCCCNNANCCCANAGCGCTCGCACCCNACCACCCN
NANNTCCGCGTGCGCGCANCTTCNNNTANTN
Sequence Type genomic DNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251798..7252140 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es