Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14590E2
Clone ID IST14590E2
Vector VICTR74
Project tigm

Sequence tag IST14590E2HMR1
Sequence
GAGGCAAATGCTTTTAACATGGTCCTGGGAACTATGACGTTGATGGCACCGGGTGTGAGGACTAGCGTAATTGTATTACT
AAGGGTCAGAGGTGTATGCAGCTATCTGGGAAGGAAGGCAGGATTTTGATTTCTGAAAGTGTTGCCTGTGTTTGTGGTTT
CCGGTTACTTTATTTATTTATGTATGTGCGGGTGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385405..127385604 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14590E2BBF1
Sequence
NCCTCNANNCNANCNNGTCNTTTTACCACACTGCNNGGTTACAGGTACATGTCCGGGTTCNTCTTGTTTTCCTTCGGTTT
TGGATTTAANGGGAATCNNNCTAAACTTTAATTGCTTTANTTTGAATACCTTTACTTTCTACTCTATTTCTCATCTTCNG
TTTGTTTCTTCNGCTCANACTCNCNACNNTGANCTGAAATTTCAATCANGCGTCTAANCCNCNNTACTGACCTACAGTAT
GGGCCCAGGAGCTTTCTGAATACTANCTGTGTACTTGTGGCCAATGTAACTCTGCCAGTATAGATATAAAAATGAATAGG
TAAAGTCCAGGTAGCTGGGAAGTAACTACCGTAATGAATTCCTGCATGTGTGAATATCAACTGTATCTAGGATTTTAAAA
ATTAGTCTTAAAACTTGTGAAAGTCAGCCNGGTGGTGGTGGTGGCGGCGGCNCACGACTTTAATCCCAGCACTTGGGAGA
NAGANGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14590E2HMF1
Sequence
GCCTCTATACTAGCATGTCTTTTTACCACACTGCAGGGTTACAGGTACATGTCCGGGTTCTTCTTGTTTTCCTTCGGTTT
TGGATTTAAAGGGAATCCAGCTAAACTTTAATTGCTTTAATTTGAATACCTTTACTTTCTACTCTATTTCTCATCTTCAG
TTTGTTTCTTCTGCTCAGACTCTCAACAGTGATCTGAAATTTCAATCAGGCGTCTAAGCCTCAGTACTGACCTACAGTAT
GGGCCCAGGAGCTTTCTGAATACTAGCTGTGTACTTGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385600..127385882 283
 
EST/CDNA Est Name
  BB856728.1 - CX222847.1 - BY290584.1 - BY246304.1 - BY061595.1 - BY026963.1 - AL364524.1 - BU850947.1 - AA204567.1 - BY264275.1 - BY273068.1 - BY264208.1 - CJ080566.1 - BY013298.1 - AA204575.1 - BY769605.1 - BY009324.1 - BY088379.1 - BY142881.1 - BY034487

 
Come back to gene BB856728.1 - CX222847.1 - BY290584.1 - BY246304.1 - BY061595.1 - BY026963.1 - AL364524.1 - BU850947.1 - AA204567.1 - BY264275.1 - BY273068.1 - BY264208.1 - CJ080566.1 - BY013298.1 - AA204575.1 - BY769605.1 - BY009324.1 - BY088379.1 - BY142881.1 - BY034487


For any suggestions or comments, please send an email to unitrap@crg.es