Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11574A2
Clone ID IST11574A2
Vector VICTR76
Project tigm

Sequence tag IST11574A2BBF1
Sequence
AGACTATTACGTTGCTAACGCGACCAACCACTTGTATACCTACCAAGCTATAATGCAGTCTTGGGGCTCCCGCTCAGAAT
ATAGCCCAAACACAGGCTTTTTGCCTGTCTGTGATGCACTTTCATTTGCCACGGGGGCCAAGAAGGTGCGTAAGTGGGCG
GTAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17985500..17985668 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST11574A2HMF1
Sequence
AGACTATTACGTTGCTAACGCNACCAACCACTTGTATACCTACCAAGCTATAATGCAGTCTTGGGGCTCCCGCTCANAAT
ATAGCCCAAACACAGGCTTTTTGCCTGTCTGTGATGCACTTTCATTTGCCACGGGGGCCAANAAGGTGCGTAAGTGGGCG
GTANATCTGGTAACACTTCCACTGGGTGAACTTTGGGAANAATCCAGGACGTGAATTTAATGGGTGGCNAANCTGCNACA
GTACTGTGAANTTAGCA
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17985500..17985755 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es