Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11041A8
Clone ID IST11041A8
Vector VICTR76
Project tigm

Sequence tag IST11041A8HMR1
Sequence
TTGGTTTCTTAGCAAGCACTCCTAGCCNTTGAGAGATATCTCTAGCCTCTGCTTCACCTTCTAGGTTGAGGCTTACTAAC
TGAAAATTTTATCTTATAGCTAACACTGCTACACTACTGAGATATTACCAAGATAACAACAGGTTGTTAGTCTTGGCTTT
GGAAAATGAGAAATCCAAAGTGAGAGAAGCACAGGATGTCNNCCTGCAACTGAGAAAAGAATGCTACTACCTTACTTGTC
AGCTGTATGCATTGAAAGAGAAGCTAACTTCCCGACAAAGTGAAGAAACTACTCANGTATATTCAGTACAAAACTTTTCT
GTGTAGTTTTGCCATATGCAGTTCAGCTTTATATAGATTTAGATATGGAAAATATTCTTAAGTATTCTTCGGANANTCNN
TTTTTAANANAATACTTCNNTATN
Sequence Type genomic DNA
Unitrap ID UNI24150

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53826282..53826704 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]


Sequence tag IST11041A8BBF1
Sequence
CAGCAACCACATGGTGACTCACAACCATCCGTAACGAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI31579 UNI32481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46311961..46312003 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50129868..50129910 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 54732291..54732333 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18122984..18123026 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124115129..124115171 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049550 (Clip1) NM_019765 CAP-GLY domain containing linker protein 1 Gene [Source:MGI (curated);Acc:Clip1-008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 118002068..118002110 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35927572..35927614 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 164615821..164615863 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040225 (Bat2d) NM_001081290 BAT2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913754]


Sequence tag IST11041A8HMF2
Sequence
CAATGAGGCCCACAGGTCAAATCCCCTAAAGAGCCAGGTGTGGTCCTGCACACTGGTGACTCTATCTGCTGTGGCAGGAC
GGAGGGAAGGTAAGGTGTTAAAGGTGTGTGGAGACAGGAGGATCTCTGGGGCTTGACTGGCTGCCACAATAGTTCCTTGT
TCAGTGAGAGACCCTTTGCAGGGGAACAGGGCAGAGATTAATAGCAGGACTCCAGAACTTCTACTACAGCAACACCCCAC
TGTGCTCCACACACAAAGAAACACACACAACACACACNNATGCCNCACTTTCAAAGTAAGAATGCTGGAAGAAGACAACA
CANAATTCTCTTACTGGGTACTTGGCCCGGTGCAACAATAAAGGACTTGCGTTTCCCAATCCCCGCCAAATTTTTATTCC
TTTTTTCTTTCATTCGATTCTNAATGTCTTNAANGGTATCTTGAANNGACCTTTTCTGACAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53826702..53827162 443
 
EST/CDNA Est Name
  AB193068.1 - AB193067.1 - AK154188.1 - BC089014.1 - AK014357.1 - NM_028232.1

 
Come back to gene AB193068.1 - AB193067.1 - AK154188.1 - BC089014.1 - AK014357.1 - NM_028232.1


For any suggestions or comments, please send an email to unitrap@crg.es