Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D028G06
Clone ID D028G06
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D028G06
Sequence
AGACTCTACAGGAGCAGGTAATTNNNTGGTCCACAAGCGGTCTCCTTNNNGTCGANNNCAAAAGACCTCAGCATCCTTGA
ACAAGCTGTCTTTACAGGATGGACATAAAGCCAAAAAACCAGCATGTAAATTTGAAGAGGGTCAAGATGTCTTAGCTAGA
TGGTCAGATGGCTTGTTTTATCTTGGAACTATCAAAAAGATAAACATATTGAAACAGAGCTGCTTCATCATATTTGAGGA
CAGTTCCAAATCCTGGGTTCTCTGGAAGGACATCCAAACAG
Sequence Type mRNA
Unitrap ID UNI3145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108509844..108510237 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 5SD028G06
Sequence
GATCTAAGCTCTTGATGTTCGTGGTTGAGGAGTGGAACAAGTTCTTAATCACTAAACCATCTTTCTTTTCTTTGGTATTA
TTAAAATGAAAAAGCTAAGACTTCATAGATAGCTTAATTTGTAGTAAGGAAGACAGTAGGCAATTAAGTTAGGCTAGTAA
TCTTGTAATTTGATAGTAAAAAAGACAGACTTGGATTTTACAGATAAAGATGATTTTCGGGTTTCTTAGGCTTGTTTCTT
GAGTACGTACAGTTTATTGGATTAATAACTTCCTCTTCTGCAGAATTACCTTCTTCCTTACCAGTCCACATGGAAATGGT
GGGAGTTATATTAGGCATCTACNNNTCATGGAGGCTATAC
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108513073..108513432 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


SPLK-Sequence tag 3SD028G06
Sequence
AACCCTTTCTTTTGAAACAACACATTTACCATGATAAGGCTCAACTCATATTGACTAATTGTAGCCATAAACCCAGAAGC
TATGGAACAAATCACAGTAAACAAAATTTGGAAGAGACAGAGGACCTAAGTAGACAAATAGTCAATAATACAAAAACAGG
CAAAGTAATAAAATAATAATTGGTAACTTCTATGTTACCTATATCTTACAGAATAAAGAAGTAATGAAGAAAATTTGTTT
TCTTCCACTAGATGGAATATTATGCAGCTGTTAGAGGTTATAATTTGAAAAACTGGCTATGTGAAAATGCTTTGGTAGAA
GTATTTCCTTGTATTNNNGAGAAGAATCAGTGTATGGTGGGAAGAACATGGCTTCTGGCACATCAGGGTTTGACATCTAG
TGTTGATACTTTCTAACTGAGACTACTNNNNGCAGTTCCTTCATCTGCTTGACTATCACTTCTTTATGAATAGTATATTN
ACATAGTCTG
Sequence Type genomic DNA
Unitrap ID UNI15236

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108513751..108514240 472
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es