Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14975H3
Clone ID IST14975H3
Vector VICTR76
Project tigm

Sequence tag IST14975H3BBF1
Sequence
ACAGGTGGAGGCGTAACTCAGTCCTTGAGAAACAAAGTGTAAGGGTCTGTGATTCAATGAAGAATGATACCCCTGACTCA
AATAGTATGTAAATGCAAAGGCTTTTATTCTGCAGAAGAAGAGCATGCTGGGGTCCCTCATTACCAAGATAGAGAGACAA
CCAAGTGAGCTTGCAGGCCTGATTTAAAGCTTGTCAGGGGATTCCAGGGTAGGTGGTGACCTTTGTCTTGCTCCACCTCT
GAGGACATTTCATTACCAGGCCATGGGGGCTGGAAACTTNNTGGGGAGGTCTGGANNCTGCTGCTGACCCANTGTN
Sequence Type genomic DNA
Unitrap ID UNI30846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103705101..103705415 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]


Sequence tag IST14975H3HMF1
Sequence
ACAGGTGGAGGCGTAACTCAGTCCTTGAGAAACAAAGTGTAAGGGTCTGTGATTCAATGAAGAATGATACCCCTGACTCA
AATAGTATGTAAATGCAAAGGCTTTTATTCTGCAGAAGAAGAGCATGCTGGGGTCCCTCATTACCAAGATAGAGAGAA
Sequence Type genomic DNA
Unitrap ID UNI30846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103705259..103705415 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]

 
Come back to gene ENSMUSG00000034751


For any suggestions or comments, please send an email to unitrap@crg.es