Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056B7
Clone ID IST15056B7
Vector VICTR80
Project tigm

Sequence tag IST15056B7HMR1
Sequence
CTCTTAGTTAAAGTGTGGAGAAGGACTTGCCCTTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81997729..81997766 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]


Sequence tag IST15056B7BBF1
Sequence
AGAGCTGTCCTGAGTCTCAGAAGAAAACACAAATGAAACGCACACCTGGCGCACGAGCATAATACGAGATTATGGGAAAC
TTTAAGATGATTAGGAGAAATCTAGCAATTCTCCAGCCCTTCCCAAGTGCCATAAAACCAAAGGAAAGGGCAGTCCGAGG
GAGGGCGCACAGGCTTGGGTTTGGTGCTGTTTGGGCCTGGGTCTCAGGAAGGCAGCTCCAGGAGCCGTGAGGACAGATTA
CTTCTCTCTCACCACAAAAGGCTGGCTGGGACATAAATACACACTTGATTCTTTGCTCTGAGGTGAAATAAGATAATTTA
TGCAAAACGCCAGCAAGGGGCGGGCCCTCAGGAAGCCCCTTGAGCACCCACTGNNCACGCACTTGGGCCTGCTTAAAGTT
TACTCCACCAAGCGCTCGCTCTCANAGCTCTCANAGCTCCCTTTGCTGGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81997277..81997732 448
NO GENE  

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es