Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14200A3
Clone ID IST14200A3
Vector VICTR74
Project tigm

Sequence tag IST14200A3HMR1
Sequence
CCAGTGTGGTGGGCAACAGTAGGATCCTTCATTCTTCACACGCTGCTGTGCCAGCAGATGCCCAGTTCCTGGGCACGTGG
CATCATGCCCAGGGTGAGTTCAACCTTCCGCAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148242171..148242286 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14200A3BBF1
Sequence
CCTCTTGTAGAGCAGAGGTGGCCAGAAGCAGCCCCTTTGTATCTCTTCTCACCCCTGGTTCCTTCAGGAGACCCCGCTGC
TTCCCCGCTTCAGTGCTTTTAGGAGCTTTGCTTTAATTTCTTTCATATGTATTTTTACTTATGAAAAATTTAAATCAGTG
TACAAAATAATGGGTTTAGTTATTGTATTTTCACAAATATACATTGATGTANTTGGTGAAAC
Sequence Type genomic DNA
Unitrap ID UNI12939

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 79731627..79731847 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009585 (Apobec3) NM_030255 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:1933111]

 
Come back to gene ENSMUSG00000009585


For any suggestions or comments, please send an email to unitrap@crg.es